|
Department of Pharmacology and Toxicology |
![]() |
![]()
![]()
J Physiol Pharmacol 2008,
59:3-15
Identification
of a presynaptic cannabinoid CB1 receptor in the guinea-pig
atrium and sequencing of the guinea-pig CB1 receptor.
Kurz CM, Gottschalk
C, Schlicker E, Kathmann M.
Institut für Pharmakologie und Toxikologie, Rheinische
Friedrich-Wilhelms-Universität Bonn, 53113 Bonn, Germany.
We studied whether cannabinoid CB(1) receptors occur on the
sympathetic neurones innervating the guinea-pig atrium and renal
cortex. Atrial and cortical kidney pieces preincubated with
[(3)H]-noradrenaline were superfused and the electrically (3
Hz)-evoked tritium overflow was examined. The evoked overflow in
atrium was inhibited by the cannabinoid agonist WIN 55,212-2
maximally by 35%; its concentration-response curve was shifted to
the right by the CB(1) antagonist rimonabant (pA(2) 8.3), which,
by itself, did not affect the evoked overflow. The evoked
overflow in the renal cortex was not altered by WIN 55,212-2. The
muscarinic agonist oxotremorine and prostaglandin E(2) inhibited
the evoked overflow maximally by 55 and 65% in atrium and by 80
and 55% in kidney, respectively. Furthermore, the nucleotide
sequence of the guinea-pig CB(1) receptor was determined (GenBank
DQ355990). The deduced amino acid sequence has a high homology to
the corresponding sequence of man (98.7%) and rat or mouse
(99.2%). In conclusion, presynaptic CB(1) receptors leading to
inhibition of noradrenaline release occur in guinea-pig atrium
but not renal cortex. The deduced amino acid sequence of the
guinea-pig CB(1) receptor shows a homology of 99% to the CB(1)
receptor sequence of rodents and humans.
Naunyn-Schmiedebergs Arch Pharmacol 2006, 372:354361
Cannabidiol is an allosteric
modulator at mu- and delta-opioid receptors.
Kathmann M, Flau K, Redmer
A, Tränkle C, Schlicker E
Department of Pharmacology
and Toxicology, School of Medicine, University of Bonn,
Reuterstr. 2b, 53113, Bonn, Germany, m.kathmann@uni-bonn.de
The mechanism of action of cannabidiol, one of the major
constituents of cannabis, is not well understood but a
noncompetitive interaction with mu opioid receptors has been
suggested on the basis of saturation binding experiments. The aim
of the present study was to examine whether cannabidiol is an
allosteric modulator at this receptor, using kinetic binding
studies, which are particularly sensitive for the measurement of
allosteric interactions at G protein-coupled receptors. In
addition, we studied whether such a mechanism also extends to the
delta opioid receptor. For comparison,
(-)-Delta(9)-tetrahydrocannabinol (THC; another major constituent
of cannabis) and rimonabant (a cannabinoid CB(1) receptor
antagonist) were studied. In mu opioid receptor binding studies
on rat cerebral cortex membrane homogenates, the agonist
(3)H-DAMGO bound to a homogeneous class of binding sites with a
K(D) of 0.68+/-0.02 nM and a B(max) of 203+/-7 fmol/mg protein.
The dissociation of (3)H-DAMGO induced by naloxone 10 muM (half
life time of 7+/-1 min) was accelerated by cannabidiol and THC
(at 100 muM, each) by a factor of 12 and 2, respectively. The
respective pEC(50) values for a half-maximum elevation of the
dissociation rate constant k(off) were 4.38 and 4.67; (3)H-DAMGO
dissociation was not affected by rimonabant 10 muM. In delta
opioid receptor binding studies on rat cerebral cortex membrane
homogenates, the antagonist (3)H-naltrindole bound to a
homogeneous class of binding sites with a K(D) of 0.24+/-0.02 nM
and a B(max) of 352+/-22 fmol/mg protein. The dissociation of
(3)H-naltrindole induced by naltrindole 10 muM (half life time of
119+/-3 min) was accelerated by cannabidiol and THC (at 100 muM,
each) by a factor of 2, each. The respective pEC(50) values were
4.10 and 5.00; (3)H-naltrindole dissociation was not affected by
rimonabant 10 muM. The present study shows that cannabidiol is an
allosteric modulator at mu and delta opioid receptors. This
property is shared by THC but not by rimonabant
Trends Pharmacol Sci
2001, 22:565-572
Modulation of transmitter
release via presynaptic cannabinoid receptors
Schlicker E, Kathmann M
Institut fur Pharmakologie und Toxikologie, Universitat Bonn,
Reuterstr. 2b, 53113, Bonn, Germany
Cannabis (marijuana) is not only a frequently abused drug but
also has the potential for the development of useful agents for
the treatment of emesis, anorexia and multiple sclerosis. In this
article, the effects of modulation of transmitter release by
cannabinoids in both the CNS and the PNS of various species,
including humans, will be discussed. Cannabinoids inhibit
neurotransmitter release via specific presynaptic cannabinoid
CB(1) receptors. Studies using either the CB(1) receptor
antagonist and inverse agonist SR141716 or
CB(1)-receptor-deficient mice suggest that numerous presynaptic
cannabinoid receptors are tonically activated by endogenous
cannabinoids and/or are constitutively active.
CB(1)-receptor-mediated inhibition of transmitter release might
explain, for example, reinforcing properties and memory
impairment caused by cannabinoids.
Br J Pharmacol 2001, 132:1169-1173
Enhanced acetylcholine
release in the hippocampus of cannabinoid CB1 receptor-deficient
mice
Kathmann M, Weber B, Zimmer A, Schlicker E
Institut fur Pharmakologie und Toxikologie, Rheinische
Friedrich-Wilhelms-Universitat Bonn, Reuterstr. 2b, 53113 Bonn,
Germany
Klinik fur Psychiatrie und Psychotherapie, Rheinische
Friedrich-Wilhelms-Universitat Bonn, Sigmund-Freud-Str. 25, 53105
Bonn, Germany
We examined whether acetylcholine release in the hippocampus and
striatum and noradrenaline release in the hippocampus is altered
in CB1 receptor-deficient mice. The electrically evoked tritium
overflow from hippocampal slices preincubated with [3H]-choline
was increased by about 100% in CB1(-/-) compared to CB1(+/+) mice
whereas the electrically evoked tritium overflow from striatal
slices preincubated with [3H]-choline and from hippocampal slices
preincubated with [3H]-noradrenaline did not differ. The
cannabinoid receptor agonist, WIN 55,212-2, inhibited, and the
CB(1) receptor antagonist, SR 141716, facilitated, the evoked
tritium overflow from hippocampal slices (preincubated with
[3H]-choline) from CB1(+/+) as opposed to CB1(-/-) mice. Both
drugs did not affect the evoked tritium overflow from striatal
slices (preincubated with [3H]-choline) and from hippocampal
slices (preincubated with [3H]-noradrenaline) from CB1(+/+) and
CB1(-/-) mice. The selective increase in acetylcholine release in
CB1(-/-) mice may indicate that the presynaptic CB1 receptors on
the cholinergic neurones of the mouse hippocampus are tonically
activated and/or constitutively active in vivo.
Naunyn-Schmiedeberg's Arch
Pharmacol 2001, 363:50-56
Cannabinoid CB1
receptor-mediated inhibition of acetylcholine release in the
brain of NMRI, CD-1 and C57BL/6J mice
Kathmann M, Weber
B, Schlicker E
Institut für Pharmakologie und Toxikologie, Rheinische
Friedrich-Wilhelms-Unversität Bonn, Reuterstrasse 2b, 53113
Bonn, Germany
Cannabinoid CB1 receptors occur as presynaptic receptors
producing inhibition of neurotransmitter release. To elucidate
their physiological role, experiments on tissues from CB1
receptor knockout mice would be helpful. We studied whether CB1
receptor-mediated inhibition of acetylcholine release is
detectable in the brain of NMRI mice and of CD-1 and C57BL/6J
mice (the latter two strains representing the wild-type strains
of the two CB1 receptor knockout mouse models). Brain slices
preincubated with [3H]choline were superfused and tritium
overflow was evoked electrically (3 Hz) or by introduction
of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing
tetrodotoxin. The electrically evoked tritium overflow
from NMRI mouse hippocampal slices was inhibited (maximally by
60%) by the cannabinoid receptor agonists CP-55,940 and WIN
55,212-2 but not affected by WIN 55,212-3 (the inactive
enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and <5.5). The
concentration-response curve of WIN 55,212-2 was shifted to the
right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6).
Compared to hippocampal slices from NMRI mice, WIN 55,212-2
1 µM inhibited the electrically evoked overflow (1) from
cortical slices from NMRI mice to a lesser extent and from
striatal slices not at all, (2) from hippocampal slices from CD-1
and C57BL/6J mice to an identical extent and (3) from hippocampal
slices from Sprague-Dawley rats to at least the same extent. SR
141716 0.32 µM abolished the effect of WIN 55,212-2
1 µM in hippocampal slices from NMRI, CD-1 and C57BL/6J
mice and in cortical slices from NMRI mice. The electrically
evoked tritium overflow from NMRI mouse hippocampal slices was
also inhibited by the muscarinic receptor agonist oxotremorine
(maximum effect of 85%; pEC50=6.5) and this effect was
antagonized by the muscarinic receptor antagonist AF-DX 384
(apparent pA2=8.3). The Ca2+-evoked tritium
overflow from NMRI mouse hippocampal slices was inhibited by WIN
55,212-2 in a manner sensitive to SR 141716. In conclusion, the
cholinergic axon terminals of the NMRI mouse hippocampus are
endowed with presynaptic CB1 receptors. Such receptors are also
detectable in the hippocampus of CD-1 and C57BL/6J mice. The
maximum extent of the CB1 receptor-mediated inhibition of
acetylcholine release is lower than the maximum effect mediated
via the autoreceptor.
Naunyn-Schmiedeberg's Arch
Pharmacol 1999, 360:421-427
CB1 receptor density and
CB1 receptor-mediated functional effects in rat hippocampus are
decreased by an intracerebroventricularly administered antisense
oligodeoxynucleotide
Kathmann M, Bauer U, Schlicker E
Institut fur Pharmakologie und Toxikologie, Rheinische
Friedrich-Wilhelms-Universitat Bonn, Germany
We have studied (i) the effect of antisense oligodeoxynucleotides
complementary to CB1 mRNA on the CB1 receptor binding in
hippocampus, striatum and cerebral cortex of the rat; (ii) the
possible mechanism of action of one of the antisense
oligodeoxynucleotides; and (iii) its effect on two functional CB1
receptor-mediated effects. Synthetic oligodeoxynucleotides or
saline were administered to male Wistar rats by the
intracerebroventricular (i.c.v.) route twice daily for 3 days.
Antisense oligodeoxynucleotides corresponding to the nucleotides
4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2;
GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide
differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were
used. The dissociation constant (K(D)) of rat CB1 cannabinoid
receptors, labelled by the radioligand [3H]-SR141716, did not
differ in membranes from rats treated with saline, AS , AS2 or
MM. The density of receptor binding (Bmax) was reduced by the
antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS
1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in
the cerebral cortex. When the dose of AS1 was raised to 30 nmol,
the reduction of Bmax in the hippocampus and striatum was only
marginally increased; a dose of 3nmol of AS1 reduced Bmax in both
brain regions by somewhat more than the half-maximum effect. The
mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax.
In the second part of the study, RNA obtained from the three
brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or
saline was analyzed using reverse transcription-polymerase chain
reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used
as reference value). The ratio of CB1 receptor mRNA over
beta-actin mRNA after treatment with AS1 did not differ from the
ratios following treatment with saline or MM in the hippocampus,
striatum and cerebral cortex. Finally, pretreatment with
antisense oligodeoxynucleotide AS1 30nmol attenuated two
functional effects via CB1 receptors, i.e., the facilitatory
effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat
hippocampus membranes and the inhibitory effect of WIN 55,212-2
on acetylcholine release in rat hippocampus slices. In
conclusion, (i) two antisense oligodeoxynucleotides reduce the
density of CB1 receptors in the rat hippocampus and striatum
after i.c.v. administration. (ii) The effect of the antisense
oligodeoxynucleotide AS1 does not appear to be related to
breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1
attenuated the CB1 receptor-mediated effect in two functional
models.
Naunyn-Schmiedeberg's Arch
Pharmacol 1999, 359:466-470 ![]()
Cannabinoid CB1
receptor-mediated inhibition of NMDA- and kainate-stimulated
noradrenaline and dopamine release in the brain
Kathmann M, Bauer U,
Schlicker E, Göthert M
Institute of Pharmacology and Toxicology, University of Bonn,
Reuterstrasse 2b, D-53113 Bonn, Germany Fax: +49-228-735404
Guinea-pig hippocampal slices preincubated with [3H]noradrenaline
were superfused with medium containing desipramine and
rauwolscine and rat striatal slices preincubated with
[3H]dopamine were superfused with medium containing nomifensine;
the effect of cannabinoid receptor ligands on tritium overflow
stimulated by NMDA or kainate was examined. Furthermore, the
affinity of the drugs for cannabinoid CB1 receptors was
determined in rat brain cortex membranes using [3H]SR 141716. In
guinea-pig hippocampal slices preincubated with
[3H]noradrenaline, tritium overflow stimulated by NMDA 100 µM
and 1000 µM and by kainate 1000 µM was inhibited by the
cannabinoid receptor agonists CP-55,940 and/or WIN 55,212-2. The
CB1 receptor antagonist SR 141716 increased the NMDA (1000
µM)-stimulated tritium overflow but did not affect tritium
overflow stimulated by NMDA 100 µM or kainate 1000 µM. The
inhibitory effect of WIN 55,212-2 on the NMDA (100 µM)- and
kainate (1000 µM)-evoked tritium overflow was antagonized by SR
141716. In rat striatal slices preincubated with [3H]dopamine,
WIN 55,212-2 inhibited the NMDA (1000 µM)-stimulated tritium
overflow. SR 141716, which, by itself, did not affect tritium
overflow, counteracted the inhibitory effect of WIN 55,212-2.
[3H]SR 141716 binding to rat cortical membranes was inhibited by
SR 141716, CP-55,940 and WIN 55,212-2 (pKi 8.53, 7.34 and 5.93,
respectively) but not affected by desipramine, rauwolscine and
nomifensine (pKi < 5). In conclusion, activation of CB1
receptors inhibits the NMDA- and kainate-stimulated noradrenaline
release in guinea-pig hippocampus and the NMDA-stimulated
dopamine release in rat striatum. The explanation for the
facilitatory effect of SR 141716 might be that it acts as an
inverse agonist at CB1 receptors or that these receptors are
activated by endogenous cannabinoids.
Biochem Biophys Res Commun
1996, 225: 333-339
Cloning and selective
expression in brain and kidney of ARNT2 homologous to the Ah
receptor nuclear translocator (ARNT)
Drutel G, Kathmann M,
Heron A, Schwartz JC, Arrang JM
Unite de Neurobiologie et Pharmacologie (U.109) de l'INSERM,
Centre Paul Broca, Paris, France
Arnt2, a new member of the basic-helix-loop-helix transcription
factor family, was cloned from rat brain cDNAs. Its deduced 712
amino acid sequence displays 63% identity with that of the aryl
hydrocarbon receptor nuclear translocator (Arnt1) that was
completely established. Whereas Arnt2 gene expression,
established by Northern blotting and in situ hybridization
histochemistry, occurred selectively in brain and kidney, that of
Arnt1 was ubiquitous, suggesting that the two proteins play
distinct roles, presumably via dimerization and DNA binding with
different partners.
Psychopharmacology (Berl)
1994, 116: 464-468
Intermediate affinity and
potency of clozapine and low affinity of other neuroleptics and
of antidepressants at H3 receptors
Kathmann M, Schlicker E,
Göthert M
Institute of Pharmacology and Toxicology, University of Bonn,
Germany
It was the aim of the present study to determine the affinities
of four neuroleptics and five antidepressants for histamine H3
receptors. In rat brain cortex membranes, the specifically bound
[3H]-N alpha-methylhistamine was monophasically displaced by
clozapine (pKi 6.15). The other drugs did not completely displace
the radioligand even at 100 microM; the pKi values were:
haloperidol (4.91); sulpiride (4.73); amitriptyline (4.56);
desipramine (4.15); levomepromazine (4.14); fluovoxamine (4.13);
maprotiline (4.09); moclobemide (< 4.0). The effect of
clozapine was further examined in a functional H3 receptor model,
i.e., in superfused mouse brain cortex slices preincubated with
[3H]-noradrenaline. The electrically evoked tritium overflow was
not affected by clozapine 0.5-32 5M. However, clozapine shifted
the concentration-response curve of histamine for its inhibitory
effect on the evoked overflow to the right, but did not affect
the maximum effect of histamine. The Schild plot yielded a pA2
value of 6.33. In conclusion, clozapine shows an intermediate
affinity and potency (as a competitive antagonist) at H3
receptors. The Ki value of clozapine at H3 receptors resembles
ist Ki value at D2 receptors (the target of the classical
neuroleptics), but is higher than its Ki values at D4, 5-HT2 or
muscarinic acetylcholine receptors, which according to current
hypotheses, might be involved in the atypical profile of
clozapine.
| [Start] [Research] [Homepage] [Publications] [Poster] [Download] [Curriculum Vitae] [Links] [Impressum] |
© Kathmann, last modified 11.01.2012
![]()