Mainpage Privatdozent Dr. Markus Kathmann

Institut für Pharmakologie und Toxikologie
Universität Bonn
Sigmund-Freud-Straße 25 - 53127 Bonn - Germany

Bild PD Dr. Markus Kathmann - Zur Person

J Physiol Pharmacol 2008, 59:3-15

Identification of a presynaptic cannabinoid CB1 receptor in the guinea-pig atrium and sequencing of the guinea-pig CB1 receptor.

Kurz CM, Gottschalk C, Schlicker E, Kathmann M.

Institut für Pharmakologie und Toxikologie, Rheinische Friedrich-Wilhelms-Universität Bonn, 53113 Bonn, Germany.

We studied whether cannabinoid CB(1) receptors occur on the sympathetic neurones innervating the guinea-pig atrium and renal cortex. Atrial and cortical kidney pieces preincubated with [(3)H]-noradrenaline were superfused and the electrically (3 Hz)-evoked tritium overflow was examined. The evoked overflow in atrium was inhibited by the cannabinoid agonist WIN 55,212-2 maximally by 35%; its concentration-response curve was shifted to the right by the CB(1) antagonist rimonabant (pA(2) 8.3), which, by itself, did not affect the evoked overflow. The evoked overflow in the renal cortex was not altered by WIN 55,212-2. The muscarinic agonist oxotremorine and prostaglandin E(2) inhibited the evoked overflow maximally by 55 and 65% in atrium and by 80 and 55% in kidney, respectively. Furthermore, the nucleotide sequence of the guinea-pig CB(1) receptor was determined (GenBank DQ355990). The deduced amino acid sequence has a high homology to the corresponding sequence of man (98.7%) and rat or mouse (99.2%). In conclusion, presynaptic CB(1) receptors leading to inhibition of noradrenaline release occur in guinea-pig atrium but not renal cortex. The deduced amino acid sequence of the guinea-pig CB(1) receptor shows a homology of 99% to the CB(1) receptor sequence of rodents and humans.

Cannabidiol is an allosteric modulator at mu- and delta-opioid receptors.

Kathmann M, Flau K, Redmer A, Tränkle C, Schlicker E

Department of Pharmacology and Toxicology, School of Medicine, University of Bonn, Reuterstr. 2b, 53113, Bonn, Germany, m.kathmann@uni-bonn.de

The mechanism of action of cannabidiol, one of the major constituents of cannabis, is not well understood but a noncompetitive interaction with mu opioid receptors has been suggested on the basis of saturation binding experiments. The aim of the present study was to examine whether cannabidiol is an allosteric modulator at this receptor, using kinetic binding studies, which are particularly sensitive for the measurement of allosteric interactions at G protein-coupled receptors. In addition, we studied whether such a mechanism also extends to the delta opioid receptor. For comparison, (-)-Delta(9)-tetrahydrocannabinol (THC; another major constituent of cannabis) and rimonabant (a cannabinoid CB(1) receptor antagonist) were studied. In mu opioid receptor binding studies on rat cerebral cortex membrane homogenates, the agonist (3)H-DAMGO bound to a homogeneous class of binding sites with a K(D) of 0.68+/-0.02 nM and a B(max) of 203+/-7 fmol/mg protein. The dissociation of (3)H-DAMGO induced by naloxone 10 muM (half life time of 7+/-1 min) was accelerated by cannabidiol and THC (at 100 muM, each) by a factor of 12 and 2, respectively. The respective pEC(50) values for a half-maximum elevation of the dissociation rate constant k(off) were 4.38 and 4.67; (3)H-DAMGO dissociation was not affected by rimonabant 10 muM. In delta opioid receptor binding studies on rat cerebral cortex membrane homogenates, the antagonist (3)H-naltrindole bound to a homogeneous class of binding sites with a K(D) of 0.24+/-0.02 nM and a B(max) of 352+/-22 fmol/mg protein. The dissociation of (3)H-naltrindole induced by naltrindole 10 muM (half life time of 119+/-3 min) was accelerated by cannabidiol and THC (at 100 muM, each) by a factor of 2, each. The respective pEC(50) values were 4.10 and 5.00; (3)H-naltrindole dissociation was not affected by rimonabant 10 muM. The present study shows that cannabidiol is an allosteric modulator at mu and delta opioid receptors. This property is shared by THC but not by rimonabant

Trends Pharmacol Sci 2001, 22:565-572

Modulation of transmitter release via presynaptic cannabinoid receptors

Schlicker E, Kathmann M

Institut fur Pharmakologie und Toxikologie, Universitat Bonn, Reuterstr. 2b, 53113, Bonn, Germany

Cannabis (marijuana) is not only a frequently abused drug but also has the potential for the development of useful agents for the treatment of emesis, anorexia and multiple sclerosis. In this article, the effects of modulation of transmitter release by cannabinoids in both the CNS and the PNS of various species, including humans, will be discussed. Cannabinoids inhibit neurotransmitter release via specific presynaptic cannabinoid CB(1) receptors. Studies using either the CB(1) receptor antagonist and inverse agonist SR141716 or CB(1)-receptor-deficient mice suggest that numerous presynaptic cannabinoid receptors are tonically activated by endogenous cannabinoids and/or are constitutively active. CB(1)-receptor-mediated inhibition of transmitter release might explain, for example, reinforcing properties and memory impairment caused by cannabinoids.

Br J Pharmacol 2001, 132:1169-1173

Enhanced acetylcholine release in the hippocampus of cannabinoid CB1 receptor-deficient mice

Kathmann M, Weber B, Zimmer A, Schlicker E

Institut fur Pharmakologie und Toxikologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Reuterstr. 2b, 53113 Bonn, Germany
Klinik fur Psychiatrie und Psychotherapie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Sigmund-Freud-Str. 25, 53105 Bonn, Germany

We examined whether acetylcholine release in the hippocampus and striatum and noradrenaline release in the hippocampus is altered in CB1 receptor-deficient mice. The electrically evoked tritium overflow from hippocampal slices preincubated with [3H]-choline was increased by about 100% in CB1(-/-) compared to CB1(+/+) mice whereas the electrically evoked tritium overflow from striatal slices preincubated with [3H]-choline and from hippocampal slices preincubated with [3H]-noradrenaline did not differ. The cannabinoid receptor agonist, WIN 55,212-2, inhibited, and the CB(1) receptor antagonist, SR 141716, facilitated, the evoked tritium overflow from hippocampal slices (preincubated with [3H]-choline) from CB1(+/+) as opposed to CB1(-/-) mice. Both drugs did not affect the evoked tritium overflow from striatal slices (preincubated with [3H]-choline) and from hippocampal slices (preincubated with [3H]-noradrenaline) from CB1(+/+) and CB1(-/-) mice. The selective increase in acetylcholine release in CB1(-/-) mice may indicate that the presynaptic CB1 receptors on the cholinergic neurones of the mouse hippocampus are tonically activated and/or constitutively active in vivo.

Naunyn-Schmiedeberg's Arch Pharmacol 2001, 363:50-56

Cannabinoid CB1 receptor-mediated inhibition of acetylcholine release in the brain of NMRI, CD-1 and C57BL/6J mice

Kathmann M, Weber B, Schlicker E

Institut für Pharmakologie und Toxikologie, Rheinische Friedrich-Wilhelms-Unversität Bonn, Reuterstrasse 2b, 53113 Bonn, Germany

Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and <5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 µM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 µM abolished the effect of WIN 55,212-2 1 µM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.

Naunyn-Schmiedeberg's Arch Pharmacol 1999, 360:421-427

CB1 receptor density and CB1 receptor-mediated functional effects in rat hippocampus are decreased by an intracerebroventricularly administered antisense oligodeoxynucleotide

Kathmann M, Bauer U, Schlicker E

Institut fur Pharmakologie und Toxikologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Germany

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Naunyn-Schmiedeberg's Arch Pharmacol 1999, 359:466-470

Cannabinoid CB1 receptor-mediated inhibition of NMDA- and kainate-stimulated noradrenaline and dopamine release in the brain

Kathmann M, Bauer U, Schlicker E, Göthert M

Institute of Pharmacology and Toxicology, University of Bonn, Reuterstrasse 2b, D-53113 Bonn, Germany Fax: +49-228-735404

Guinea-pig hippocampal slices preincubated with [3H]noradrenaline were superfused with medium containing desipramine and rauwolscine and rat striatal slices preincubated with [3H]dopamine were superfused with medium containing nomifensine; the effect of cannabinoid receptor ligands on tritium overflow stimulated by NMDA or kainate was examined. Furthermore, the affinity of the drugs for cannabinoid CB1 receptors was determined in rat brain cortex membranes using [3H]SR 141716. In guinea-pig hippocampal slices preincubated with [3H]noradrenaline, tritium overflow stimulated by NMDA 100 µM and 1000 µM and by kainate 1000 µM was inhibited by the cannabinoid receptor agonists CP-55,940 and/or WIN 55,212-2. The CB1 receptor antagonist SR 141716 increased the NMDA (1000 µM)-stimulated tritium overflow but did not affect tritium overflow stimulated by NMDA 100 µM or kainate 1000 µM. The inhibitory effect of WIN 55,212-2 on the NMDA (100 µM)- and kainate (1000 µM)-evoked tritium overflow was antagonized by SR 141716. In rat striatal slices preincubated with [3H]dopamine, WIN 55,212-2 inhibited the NMDA (1000 µM)-stimulated tritium overflow. SR 141716, which, by itself, did not affect tritium overflow, counteracted the inhibitory effect of WIN 55,212-2. [3H]SR 141716 binding to rat cortical membranes was inhibited by SR 141716, CP-55,940 and WIN 55,212-2 (pKi 8.53, 7.34 and 5.93, respectively) but not affected by desipramine, rauwolscine and nomifensine (pKi < 5). In conclusion, activation of CB1 receptors inhibits the NMDA- and kainate-stimulated noradrenaline release in guinea-pig hippocampus and the NMDA-stimulated dopamine release in rat striatum. The explanation for the facilitatory effect of SR 141716 might be that it acts as an inverse agonist at CB1 receptors or that these receptors are activated by endogenous cannabinoids.

Biochem Biophys Res Commun 1996, 225: 333-339

Cloning and selective expression in brain and kidney of ARNT2 homologous to the Ah receptor nuclear translocator (ARNT)

Drutel G, Kathmann M, Heron A, Schwartz JC, Arrang JM

Unite de Neurobiologie et Pharmacologie (U.109) de l'INSERM, Centre Paul Broca, Paris, France

Arnt2, a new member of the basic-helix-loop-helix transcription factor family, was cloned from rat brain cDNAs. Its deduced 712 amino acid sequence displays 63% identity with that of the aryl hydrocarbon receptor nuclear translocator (Arnt1) that was completely established. Whereas Arnt2 gene expression, established by Northern blotting and in situ hybridization histochemistry, occurred selectively in brain and kidney, that of Arnt1 was ubiquitous, suggesting that the two proteins play distinct roles, presumably via dimerization and DNA binding with different partners.

Psychopharmacology (Berl) 1994, 116: 464-468

Intermediate affinity and potency of clozapine and low affinity of other neuroleptics and of antidepressants at H3 receptors

Kathmann M, Schlicker E, Göthert M

Institute of Pharmacology and Toxicology, University of Bonn, Germany

It was the aim of the present study to determine the affinities of four neuroleptics and five antidepressants for histamine H3 receptors. In rat brain cortex membranes, the specifically bound [3H]-N alpha-methylhistamine was monophasically displaced by clozapine (pKi 6.15). The other drugs did not completely displace the radioligand even at 100 microM; the pKi values were: haloperidol (4.91); sulpiride (4.73); amitriptyline (4.56); desipramine (4.15); levomepromazine (4.14); fluovoxamine (4.13); maprotiline (4.09); moclobemide (< 4.0). The effect of clozapine was further examined in a functional H3 receptor model, i.e., in superfused mouse brain cortex slices preincubated with [3H]-noradrenaline. The electrically evoked tritium overflow was not affected by clozapine 0.5-32 5M. However, clozapine shifted the concentration-response curve of histamine for its inhibitory effect on the evoked overflow to the right, but did not affect the maximum effect of histamine. The Schild plot yielded a pA2 value of 6.33. In conclusion, clozapine shows an intermediate affinity and potency (as a competitive antagonist) at H3 receptors. The Ki value of clozapine at H3 receptors resembles ist Ki value at D2 receptors (the target of the classical neuroleptics), but is higher than its Ki values at D4, 5-HT2 or muscarinic acetylcholine receptors, which according to current hypotheses, might be involved in the atypical profile of clozapine.